| Basic information from miRBase |
| hairpin accession number: MI0008764 |
| Located between position 78805908 and 78806002 on chromosome 15 strand - |
| Overlapping with antisense strand of Q864B4_PANTR (intron 1). |
| (Ensemble: ENSPTRT00000043826) |
| mature miRNAs for MI0008764: |
| ptr-miR-549 (MIMAT0008229): TGACAACTATGGATGAGCTCT |
| You can find this miRNA in ENTREZGENE: MIR549 (accession: 100316219) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |