| Basic information from miRBase |
| hairpin accession number: MI0001459 |
| Located between position 373 and 496 on chromosome AZM5_110688 strand + |
| mature miRNAs for MI0001459: |
| zma-miR156b (MIMAT0001354): TGACAGAAGAGAGTGAGCAC |
| zma-miR156b* (MIMAT0015127): GCTCACCCTCTATCTGTCAGT |
| References |
| [1]Maher C, Timmermans M, Stein L, Ware D, Proc IEEE CSB :718-723(2004)., "Identifying microRNAs in plant genomes" |
| [2]Zhang BH, Pan XP, Wang QL, Cobb GP, Anderson TA, Cell Res. 15:336-360(2005)., "Identification and characterization of new plant microRNAs using EST analysis" |
| [3]Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D, PLoS Genet. 5:e1000716(2009)., "A genome-wide characterization of microRNA genes in maize" |