miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000759
Located between position 5919109 and 5919218 on chromosome X strand +
Overlapping with sense strand of Y23B4A.5 (exon 1).
(Ensemble: Y23B4A.5) WormBase: WormBase)
mature miRNAs for MI0000759:
         cel-miR-360* (MIMAT0015121): TTGTGACCGTTGTTACGGTCA
         cel-miR-360 (MIMAT0000702): TGACCGTAATCCCGTTCACAA

References
[1]Ohler U, Yekta S, Lim LP, Bartel DP, Burge CB, RNA. 10:1309-1322(2004)., "Patterns of flanking sequence conservation and a characteristic upstream motif for microRNA gene identification"
[2]Kato M, de Lencastre A, Pincus Z, Slack FJ, Genome Biol. 10:R54(2009)., "Dynamic expression of small non-coding RNAs, including novel microRNAs and piRNAs/21U-RNAs, during Caenorhabditis elegans development"
[3]Zisoulis DG, Lovci MT, Wilbert ML, Hutt KR, Liang TY, Pasquinelli AE, Yeo GW, Nat Struct Mol Biol. 17:173-179(2010)., "Comprehensive discovery of endogenous Argonaute binding sites in Caenorhabditis elegans"


more data
Data from CoGemiR