| Basic information from miRBase |
| hairpin accession number: MI0012568 |
| Located between position 5483110 and 5483208 on chromosome 7 strand - |
| Overlapping with sense strand of (intron 2). |
| (Ensemble: ENSPTRT00000034901) |
| mature miRNAs for MI0012568: |
| ptr-miR-589 (MIMAT0012806): TGAGAACCATGTCTGCTCTGAG |
| You can find this miRNA in ENTREZGENE: MIR589 (accession: 100316407) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |