| Basic information from miRBase |
| hairpin accession number: MI0008545 |
| Located between position 102832559 and 102832630 on chromosome 10 strand + |
| mature miRNAs for MI0008545: |
| ptr-miR-146b (MIMAT0008039): TGAGAACTGAATTCCATAGGCT |
| You can find this miRNA in ENTREZGENE: MIR146B (accession: 100316103) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |