| Basic information from miRBase |
| hairpin accession number: MI0008544 |
| Located between position 162576113 and 162576210 on chromosome 5 strand + |
| mature miRNAs for MI0008544: |
| ptr-miR-146a (MIMAT0008038): TGAGAACTGAATTCCATGGGTT |
| You can find this miRNA in ENTREZGENE: MIR146A (accession: 100316413) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |