| Basic information from miRBase |
| hairpin accession number: MI0015678 |
| Located between position 6148874 and 6148927 on chromosome 7q strand - |
| mature miRNAs for MI0015678: |
| cin-miR-4003d-3p (MIMAT0016717): TGAGAATGGTAACCAATACA |
| You can find this miRNA in ENTREZGENE: mir4003d (accession: 100499073) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |