miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000387
Located between position 642208 and 642288 on chromosome 3L strand +
mature miRNAs for MI0000387:
         dme-bantam-5p (MIMAT0020823): CCGGTTTTCGATTTGGTTTGACT
         dme-bantam-3p (MIMAT0000365): TGAGATCATTTTGAAAGCTGATT
You can find this miRNA in EMBL: DME550546 (accession: AJ550546)

References
[1]Brennecke J, Hipfner DR, Stark A, Russell RB, Cohen SM, Cell. 113:25-36(2003)., "bantam encodes a developmentally regulated microRNA that controls cell proliferation and regulates the proapoptotic gene hid in Drosophila"
[2]Lai EC, Tomancak P, Williams RW, Rubin GM, Genome Biol. 4:R42(2003)., "Computational identification of Drosophila microRNA genes"
[3]Aravin AA, Lagos-Quintana M, Yalcin A, Zavolan M, Marks D, Snyder B, Gaasterland T, Meyer J, Tuschl T, Dev Cell. 5:337-350(2003)., "The small RNA profile during Drosophila melanogaster development"
[4]Moberg KH, Hariharan IK, Trends Cell Biol. 13:455-457(2003)., "Big things from a little RNA"
[5]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs"
[6]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes"


more data
Data from CoGemiR