miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013098
Located between position 136030752 and 136030831 on chromosome 2 strand +
Overlapping with sense strand of (exon 1).
(Ensemble: ENSSSCT00000020760)
mature miRNAs for MI0013098:
         ssc-miR-143-5p (MIMAT0017374): GGTGCAGTGCTGCATCTCTGG
         ssc-miR-143-3p (MIMAT0013879): TGAGATGAAGCACTGTAGCTC
You can find this miRNA in ENTREZGENE: MIR143 (accession: 100498761)

References
[1]Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B, Anim Genet. 41:159-168(2010)., "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing"
[2]Cho IS, Kim J, Seo HY, Lim do H, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS, Mol Biol Rep. 37:3567-3574(2010)., "Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue"
[3]Sharbati S, Friedlander MR, Sharbati J, Hoeke L, Chen W, Keller A, Stahler PF, Rajewsky N, Einspanier R, BMC Genomics. 11:275(2010)., "Deciphering the porcine intestinal microRNA transcriptome"
[4]Li G, Li Y, Li X, Ning X, Li M, Yang G, J Cell Biochem. 112:1318-1328(2011)., "MicroRNA identity and abundance in developing swine adipose tissue as determined by solexa sequencing"