miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0012546
Located between position 429 and 510 on chromosome 1099214765179 strand +
Overlapping with sense strand of XM_001119053.1 (intron 11).
(Ensemble: ENSMMUT00000017598)
mature miRNAs for MI0012546:
         mml-miR-1233 (MIMAT0012789): TGAGCCCTGTCCTCCCGCAG
You can find this miRNA in ENTREZGENE: MIR1233 (accession: 100315375)

References
[1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search"