| Basic information from miRBase |
| hairpin accession number: MI0008436 |
| Located between position 29384501 and 29384580 on chromosome 15 strand + |
| mature miRNAs for MI0008436: |
| ptr-miR-1233 (MIMAT0007966): TGAGCCCTGTCCTCCCGCAG |
| You can find this miRNA in ENTREZGENE: MIR1233-3 (accession: 100316310) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |