Basic information from miRBase |
hairpin accession number: MI0008626 |
Located between position 894543 and 894635 on chromosome 7 strand - |
Overlapping with sense strand of (intron 1). |
(Ensemble: ENSPTRT00000045718) |
mature miRNAs for MI0008626: |
ptr-miR-339 (MIMAT0008107): TGAGCGCCTCGACGACAGAGCC |
You can find this miRNA in ENTREZGENE: MIR339 (accession: 100316381) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |