miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000620
Located between position 15778323 and 15778418 on chromosome 12 strand +
Overlapping with sense strand of LOC498154 (intron 2).
(Ensemble: ENSRNOT00000001734) (RGD: RGD)
mature miRNAs for MI0000620:
         rno-miR-339-5p (MIMAT0000583): TCCCTGTCCTCCAGGAGCTCACG
         rno-miR-339-3p (MIMAT0004648): TGAGCGCCTCGACGACAGAGCCA
You can find this miRNA in ENTREZGENE: Mir339 (accession: 100314146)

References
[1]Kim J, Krichevsky A, Grad Y, Hayes GD, Kosik KS, Church GM, Ruvkun G, Proc Natl Acad Sci U S A. 101:360-365(2004)., "Identification of many microRNAs that copurify with polyribosomes in mammalian neurons"
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[3]Linsen SE, de Wit E, de Bruijn E, Cuppen E, BMC Genomics. 11:249(2010)., "Small RNA expression and strain specificity in the rat"