| Basic information from miRBase |
| hairpin accession number: MI0009964 |
| Located between position 126546541 and 126546622 on chromosome 8 strand + |
| Overlapping with sense strand of Galnt2-002 (intron 1). |
| (Ensemble: OTTMUST00000064647) |
| mature miRNAs for MI0009964: |
| mmu-miR-1967 (MIMAT0009440): TGAGGATCCTGGGGAGAAGATGC |
| You can find this miRNA in MGI: Mir1967 (accession: 3837213) |
| References |
| [1]Kuchenbauer F, Morin RD, Argiropoulos B, Petriv OI, Griffith M, Heuser M, Yung E, Piper J, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Hansen CL, Marra MA, Humphries RK, Genome Res. 18:1787-1797(2008)., "In-depth characterization of the microRNA transcriptome in a leukemia progression model" |