| Basic information from miRBase |
| hairpin accession number: MI0008403 |
| Located between position 57336392 and 57336469 on chromosome 19 strand + |
| mature miRNAs for MI0008403: |
| ptr-let-7e (MIMAT0007940): TGAGGTAGGAGGTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7E (accession: 100316036) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |