Basic information from miRBase |
hairpin accession number: MI0000100 |
Located between position 53583184 and 53583302 on chromosome X strand - |
Overlapping with sense strand of HUWE1-002 (intron 34). |
(Ensemble: OTTHUMT00000056767) |
mature miRNAs for MI0000100: |
hsa-miR-98 (MIMAT0000096): TGAGGTAGTAAGTTGTATTGTT |
You can find this miRNA in EMBL: AF480570 (accession: AF480570) |
References | ||||||||||||||
[1]Mourelatos Z, Dostie J, Paushkin S, Sharma A, Charroux B, Abel L, Rappsilber J, Mann M, Dreyfuss G, Genes Dev. 16:720-728(2002)., "miRNPs: a novel class of ribonucleoproteins containing numerous microRNAs" | ||||||||||||||
[2]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing" | ||||||||||||||
[3]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer" |
PROMOTER INFORMATION | ||||||||||||||
808 | chrX, 53599909-53605027, - | promoter sequence | UCSC | |||||||||||
1365 | chrX, 53603936-53608935, - | promoter sequence | Ozsolak et al. (MALME) |
more data |
Expression data from dbDEMC |
Expression data from PhenomiR |