| Basic information from miRBase |
| hairpin accession number: MI0002696 |
| Located between position 51872188 and 51872267 on chromosome X strand - |
| Overlapping with sense strand of XM_001088879.1 (intron 60). |
| (Ensemble: ENSMMUT00000008929) |
| mature miRNAs for MI0002696: |
| mml-miR-98 (MIMAT0002404): TGAGGTAGTAAGTTGTATTGTT |
| You can find this miRNA in EMBL: AY866044 (accession: AY866044) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |