| Basic information from miRBase |
| hairpin accession number: MI0002697 |
| Located between position 53983535 and 53983653 on chromosome X strand - |
| Overlapping with sense strand of (intron 54). |
| (Ensemble: ENSPTRT00000049267) |
| mature miRNAs for MI0002697: |
| ptr-miR-98 (MIMAT0002405): TGAGGTAGTAAGTTGTATTGTT |
| You can find this miRNA in EMBL: AY866045 (accession: AY866045) |
| References |
| [1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes" |