miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0000067
Located between position 96938629 and 96938715 on chromosome 9 strand +
mature miRNAs for MI0000067:
         hsa-let-7f (MIMAT0000067): TGAGGTAGTAGATTGTATAGTT
         hsa-let-7f-1* (MIMAT0004486): CTATACAATCTATTGCCTTCCC
You can find this miRNA in EMBL: (accession: AJ421731)

References
[1]Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T, Science. 294:853-858(2001)., "Identification of novel genes coding for small expressed RNAs"
[2]Michael MZ, O' Connor SM, van Holst Pellekaan NG, Young GP, James RJ, Mol Cancer Res. 1:882-891(2003)., "Reduced accumulation of specific microRNAs in colorectal neoplasia"
[3]Kasashima K, Nakamura Y, Kozu T, Biochem Biophys Res Commun. 322:403-410(2004)., "Altered expression profiles of microRNAs during TPA-induced differentiation of HL-60 cells"
[4]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[5]Lui WO, Pourmand N, Patterson BK, Fire A, Cancer Res. 67:6031-6043(2007)., "Patterns of known and novel small RNAs in human cervical cancer"
[6]Koh W, Sheng CT, Tan B, Lee QY, Kuznetsov V, Kiang LS, Tanavde V, BMC Genomics. 11 Suppl 1:S6(2010)., "Analysis of deep sequencing microRNA expression profile from human embryonic stem cells derived mesenchymal stem cells reveals possible role of let-7 microRNA family in downstream targeting of hepatic nuclear factor 4 alpha"


PROMOTER INFORMATION
PROMOTER ID
LOCALIZATION
SEQUENCE
REFERENCE
SNP
TFBS
776 chr9, 95973450-95978536, + promoter sequence UCSC
1256 chr9, 95964131-95969130, + promoter sequence Corcoran et al.
1299 chr9, 95963990-95968989, + promoter sequence Ozsolak et al. (MALME)
1460 chr9, 95964183-95969182, + promoter sequence Ozsolak et al. (MCF7)
1528 chr9, 95964040-95969039, + promoter sequence Ozsolak et al. (UACC62)


more data
Expression data from PhenomiR