| Basic information from miRBase |
| hairpin accession number: MI0008404 |
| Located between position 93395056 and 93395141 on chromosome 9 strand + |
| mature miRNAs for MI0008404: |
| ptr-let-7f (MIMAT0007941): TGAGGTAGTAGATTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7F-1 (accession: 100316362) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |