Basic information from miRBase |
hairpin accession number: MI0008405 |
Located between position 53984504 and 53984585 on chromosome X strand - |
Overlapping with sense strand of (intron 54). |
(Ensemble: ENSPTRT00000049267) |
mature miRNAs for MI0008405: |
ptr-let-7f (MIMAT0007941): TGAGGTAGTAGATTGTATAGTT |
You can find this miRNA in ENTREZGENE: MIRLET7F-2 (accession: 100316421) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |