miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0008405
Located between position 53984504 and 53984585 on chromosome X strand -
Overlapping with sense strand of (intron 54).
(Ensemble: ENSPTRT00000049267)
mature miRNAs for MI0008405:
         ptr-let-7f (MIMAT0007941): TGAGGTAGTAGATTGTATAGTT
You can find this miRNA in ENTREZGENE: MIRLET7F-2 (accession: 100316421)

References
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome"