| Basic information from miRBase |
| hairpin accession number: MI0008398 |
| Located between position 121076349 and 121076419 on chromosome 11 strand - |
| mature miRNAs for MI0008398: |
| ptr-let-7a (MIMAT0007936): TGAGGTAGTAGGTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7A-2 (accession: 100316420) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |