| Basic information from miRBase |
| hairpin accession number: MI0008399 |
| Located between position 45296681 and 45296753 on chromosome 22 strand + |
| mature miRNAs for MI0008399: |
| ptr-let-7a (MIMAT0007936): TGAGGTAGTAGGTTGTATAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7A-3 (accession: 100316033) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |