Basic information from miRBase |
hairpin accession number: MI0008401 |
Located between position 16639744 and 16639826 on chromosome 21 strand + |
Overlapping with sense strand of (intron 5). |
(Ensemble: ENSPTRT00000060614) |
mature miRNAs for MI0008401: |
ptr-let-7c (MIMAT0007938): TGAGGTAGTAGGTTGTATGGTT |
You can find this miRNA in ENTREZGENE: MIRLET7C (accession: 100316034) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |