| Basic information from miRBase |
| hairpin accession number: MI0008401 |
| Located between position 16639744 and 16639826 on chromosome 21 strand + |
| Overlapping with sense strand of (intron 5). |
| (Ensemble: ENSPTRT00000060614) |
| mature miRNAs for MI0008401: |
| ptr-let-7c (MIMAT0007938): TGAGGTAGTAGGTTGTATGGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7C (accession: 100316034) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |