| Basic information from miRBase |
| hairpin accession number: MI0008400 |
| Located between position 45297617 and 45297698 on chromosome 22 strand + |
| mature miRNAs for MI0008400: |
| ptr-let-7b (MIMAT0007937): TGAGGTAGTAGGTTGTGTGGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7B (accession: 100316306) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |