| Basic information from miRBase |
| hairpin accession number: MI0005051 |
| Located between position 49631988 and 49632070 on chromosome 22 strand + |
| Overlapping with sense strand of A7Z085_BOVIN (intron 2). |
| (Ensemble: ENSBTAT00000003855) |
| mature miRNAs for MI0005051: |
| bta-let-7g (MIMAT0003838): TGAGGTAGTAGTTTGTACAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7G (accession: 791050) |
| References |
| [1]Coutinho LL, Matukumalli LK, Sonstegard TS, Van Tassell CP, Gasbarre LC, Capuco AV, Smith TP, Physiol Genomics. 29:35-43(2007)., "Discovery and profiling of bovine microRNAs from immune-related and embryonic tissues" |
| [2]Long JE, Chen HX, Biochem Genet. 47:329-343(2009)., "Identification and characteristics of cattle microRNAs by homology searching and small RNA cloning" |