Basic information from miRBase |
hairpin accession number: MI0008036 |
Located between position 40496653 and 40496731 on chromosome 20 strand + |
Overlapping with sense strand of XM_844652.1 (intron 2). |
(Ensemble: ENSCAFT00000015643) |
mature miRNAs for MI0008036: |
cfa-let-7g (MIMAT0006637): TGAGGTAGTAGTTTGTACAGTT |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" ![]() |