| Basic information from miRBase |
| hairpin accession number: MI0008406 |
| Located between position 53524894 and 53524976 on chromosome 3 strand - |
| Overlapping with sense strand of XM_001138603.1 (intron 2). |
| (Ensemble: ENSPTRT00000028060) |
| mature miRNAs for MI0008406: |
| ptr-let-7g (MIMAT0007942): TGAGGTAGTAGTTTGTACAGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7G (accession: 100316307) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |