| Basic information from miRBase |
| hairpin accession number: MI0008407 |
| Located between position 26907196 and 26907278 on chromosome 12 strand - |
| mature miRNAs for MI0008407: |
| ptr-let-7i (MIMAT0007943): TGAGGTAGTAGTTTGTGCTGTT |
| You can find this miRNA in ENTREZGENE: MIRLET7I (accession: 100316037) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |