Basic information from miRBase |
hairpin accession number: MI0008407 |
Located between position 26907196 and 26907278 on chromosome 12 strand - |
mature miRNAs for MI0008407: |
ptr-let-7i (MIMAT0007943): TGAGGTAGTAGTTTGTGCTGTT |
You can find this miRNA in ENTREZGENE: MIRLET7I (accession: 100316037) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" ![]() |