| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005815 |
| Located between position 5641063 and 5641155 on chromosome 2L strand + |
| Overlapping with antisense strand of CG31646-RA (intron 4). |
| (Ensemble: FBtr0079114) (FlyBase: FlyBase) |
| mature miRNAs for MI0005815: |
| dme-miR-960-5p (MIMAT0005474): TGAGTATTCCAGATTGCATAGC |
| dme-miR-960-3p (MIMAT0020855): TATACGGTCTGGGACACTTTTA |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| more data |
| Data from CoGemiR |