| Basic information from miRBase |
| hairpin accession number: MI0012567 |
| Located between position 108026667 and 108026758 on chromosome 9 strand + |
| Overlapping with sense strand of (intron 3). |
| (Ensemble: ENSPTRT00000029487) |
| mature miRNAs for MI0012567: |
| ptr-miR-571 (MIMAT0012805): TGAGTTGGCCATCTGAGCGAG |
| You can find this miRNA in ENTREZGENE: MIR571 (accession: 100316512) |
| References |
| [1]Artzi S, Kiezun A, Shomron N, BMC Bioinformatics. 9:39(2008)., "miRNAminer: a tool for homologous microRNA gene search" |