| Basic information from miRBase |
| hairpin accession number: MI0015741 |
| Located between position 1937694 and 1937748 on chromosome 3q strand + |
| mature miRNAs for MI0015741: |
| cin-miR-4005c-5p (MIMAT0016801): TGAGTTGGTATGTTTCTGGT |
| You can find this miRNA in ENTREZGENE: mir4005c (accession: 100499081) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |