| Basic information from miRBase |
| hairpin accession number: MI0015523 |
| Located between position 6166955 and 6167009 on chromosome 7q strand - |
| mature miRNAs for MI0015523: |
| cin-miR-4005a-5p (MIMAT0016463): TGAGTTGGTGCTATCATACT |
| cin-miR-4005a-3p (MIMAT0016464): CAAGGGAAAGTACCAGCTTTG |
| You can find this miRNA in ENTREZGENE: mir4005a (accession: 100498883) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |