| Basic information from miRBase |
| hairpin accession number: MI0015527 |
| Located between position 6154057 and 6154110 on chromosome 7q strand - |
| mature miRNAs for MI0015527: |
| cin-miR-4005b-5p (MIMAT0016467): TGAGTTGGTGCTATCATGCT |
| cin-miR-4005b-3p (MIMAT0016468): CAAGGGGAAGTACCAGCTCT |
| You can find this miRNA in ENTREZGENE: mir4005b (accession: 100498885) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |