| Basic information from miRBase |
| hairpin accession number: MI0015524 |
| Located between position 6151685 and 6151739 on chromosome 7q strand - |
| mature miRNAs for MI0015524: |
| cin-miR-4003c-5p (MIMAT0016465): TGAGTTGGTTATCATTGTTG |
| cin-miR-4003c-3p (MIMAT0016466): TAACGATGTTAGTCAATGCA |
| You can find this miRNA in ENTREZGENE: mir4003c (accession: 100499023) |
| References |
| [1]Hendrix D, Levine M, Shi W, Genome Biol. 11:R39(2010)., "miRTRAP, a computational method for the systematic identification of miRNAs from high throughput sequencing data" |