| Basic information from miRBase |
| hairpin accession number: MI0002027 |
| Located between position 34002214 and 34002339 on chromosome 25 strand - |
| Overlapping with sense strand of FP236163.1-201 (intron 38). |
| (Ensemble: ENSDART00000023584) |
| mature miRNAs for MI0002027: |
| dre-miR-190 (MIMAT0001854): TGATATGTTTGATATATTAGGT |
| You can find this miRNA in ENTREZGENE: mir190 (accession: 100033682) |
| References |
| [1]Chen PY, Manninga H, Slanchev K, Chien M, Russo JJ, Ju J, Sheridan R, John B, Marks DS, Gaidatzis D, Sander C, Zavolan M, Tuschl T, Genes Dev. 19:1288-1293(2005)., "The developmental miRNA profiles of zebrafish as determined by small RNA cloning" |