miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0002614
Located between position 60383077 and 60383161 on chromosome 15 strand +
Overlapping with sense strand of XM_510461.2 (intron 51).
(Ensemble: ENSPTRT00000013181)
mature miRNAs for MI0002614:
         ptr-miR-190a (MIMAT0002313): TGATATGTTTGATATATTAGGT
You can find this miRNA in EMBL: AY865952 (accession: AY865952)

References
[1]Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E, Cell. 120:21-24(2005)., "Phylogenetic shadowing and computational identification of human microRNA genes"