miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0013817
Located between position 3908501 and 3908572 on chromosome 10 strand -
Overlapping with sense strand of XP_002194889.1 (intron 52).
(Ensemble: ENSTGUT00000005416)
mature miRNAs for MI0013817:
         tgu-miR-190 (MIMAT0014589): TGATATGTTTGATATATTAGGT

References
[1]Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li, Nature. 464:757-762(2010)., "The genome of a songbird"