| Basic information from miRBase |
| hairpin accession number: MI0008563 |
| Located between position 133336394 and 133336471 on chromosome 1 strand - |
| mature miRNAs for MI0008563: |
| ptr-miR-190b (MIMAT0008055): TGATATGTTTGATATTGGGTT |
| You can find this miRNA in ENTREZGENE: MIR190B (accession: 100316112) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |