Basic information from miRBase |
hairpin accession number: MI0008563 |
Located between position 133336394 and 133336471 on chromosome 1 strand - |
mature miRNAs for MI0008563: |
ptr-miR-190b (MIMAT0008055): TGATATGTTTGATATTGGGTT |
You can find this miRNA in ENTREZGENE: MIR190B (accession: 100316112) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |