| Basic information from miRBase |
| hairpin accession number: MI0016461 |
| mature miRNAs for MI0016461: |
| hvu-miR171 (MIMAT0018220): TGATTGAGCCGTGCCAATATC |
| References |
| [1]Dryanova A, Zakharov A, Gulick PJ, Genome. 51:433-443(2008)., "Data mining for miRNAs and their targets in the Triticeae" |
| [2]Kantar M, Unver T, Budak H, Funct Integr Genomics. 10:493-507(2010)., "Regulation of barley miRNAs upon dehydration stress correlated with target gene expression" |
| [3]Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U, BMC Genomics. 12:129(2011)., "Discovery of barley miRNAs through deep sequencing of short reads_field" |