miRNEST 2.0, an integrative microRNA resource

miRNEST 2.0, an integrative microRNA resource :: Browse

Basic information from miRBase

hairpin accession number: MI0000213

Located between position 26411580 and 26411672 on chromosome 5 strand -

mature miRNAs for MI0000213:

ath-miR170 (MIMAT0000201): TGATTGAGCCGTGTCAATATC

You can find this miRNA in EMBL: (accession: AJ493655)

References

[1]Reinhart BJ, Weinstein EG, Rhoades MW, Bartel B, Bartel DP, Genes Dev. 16:1616-1626(2002)., "MicroRNAs in plants"

[2]Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP, Cell. 110:513-520(2002)., "Prediction of plant microRNA targets"

[3]Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC, Plant Physiol. 138:2145-2154(2005)., "Expression of Arabidopsis MIRNA genes"

[4]Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang W, Green PJ, Meyers BC, Genome Res. 16:1276-1288(2006)., "MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant"

[5]Rajagopalan R, Vaucheret H, Trejo J, Bartel DP, Genes Dev. 20:3407-3425(2006)., "A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana"