| Basic information from miRBase |
| hairpin accession number: MI0008584 |
| Located between position 33908728 and 33908835 on chromosome 6 strand + |
| mature miRNAs for MI0008584: |
| ptr-miR-219-5p (MIMAT0009193): TGATTGTCCAAACGCAATTCT |
| ptr-miR-219-1-3p (MIMAT0008074): AGAGTTGAGTCTGGACGTCCCG |
| You can find this miRNA in ENTREZGENE: MIR219-1 (accession: 100316123) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |