Basic information from miRBase |
hairpin accession number: MI0008585 |
Located between position 128218829 and 128218924 on chromosome 9 strand - |
mature miRNAs for MI0008585: |
ptr-miR-219-5p (MIMAT0009193): TGATTGTCCAAACGCAATTCT |
ptr-miR-219-2-3p (MIMAT0009194): AGAATTGTGGCTGGACATCTGT |
You can find this miRNA in ENTREZGENE: MIR219-2 (accession: 100316124) |
References |
[1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |