| more data |
| Data from CoGemiR |
| Basic information from miRBase |
| hairpin accession number: MI0005820 |
| Located between position 6902062 and 6902152 on chromosome 2L strand + |
| Overlapping with sense strand of neuroligin-RA (intron 3). |
| (Ensemble: FBtr0079344) (FlyBase: FlyBase) |
| mature miRNAs for MI0005820: |
| dme-miR-932-5p (MIMAT0005479): TCAATTCCGTAGTGCATTGCAG |
| dme-miR-932-3p (MIMAT0020860): TGCAAGCGCTGCGGATTTGGCA |
| References |
| [1]Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC, Genome Res. 17:1850-1864(2007)., "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" |
| [2]Stark A, Kheradpour P, Parts L, Brennecke J, Hodges E, Hannon GJ, Kellis M, Genome Res. 17:1865-1879(2007)., "Systematic discovery and characterization of fly microRNAs using 12 Drosophila genomes" |
| more data |
| Data from CoGemiR |