Basic information from miRBase |
hairpin accession number: MI0007991 |
Located between position 30368459 and 30368519 on chromosome 10 strand + |
Overlapping with sense strand of XM_538392.2 (intron 1). |
(Ensemble: ENSCAFT00000002352) |
mature miRNAs for MI0007991: |
cfa-miR-1835 (MIMAT0006596): TGCACCCTGAGAGCTGGAGCAG |
References |
[1]Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N, Nat Biotechnol. 26:407-415(2008)., "Discovering microRNAs from deep sequencing data using miRDeep" ![]() |