| Basic information from miRBase |
| hairpin accession number: MI0008487 |
| Located between position 18732641 and 18732717 on chromosome 22 strand - |
| Overlapping with sense strand of XM_514992.2 (intron 1). |
| (Ensemble: ENSPTRT00000026306) |
| mature miRNAs for MI0008487: |
| ptr-miR-1286 (MIMAT0008005): TGCAGGACCAAGATGAGCCCT |
| You can find this miRNA in ENTREZGENE: MIR1286 (accession: 100316079) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |