This microRNA is imprinted (based on ncRNAimprinted database) |
| Basic information from miRBase |
| hairpin accession number: MI0006280 |
| Located between position 10398777 and 10398899 on chromosome 2 strand + |
| Overlapping with sense strand of Sfmbt2-001 (intron 10). |
| (Ensemble: OTTMUST00000026263) |
| mature miRNAs for MI0006280: |
| mmu-miR-669g (MIMAT0005832): TGCATTGTATGTGTTGACATGAT |
| You can find this miRNA in MGI: Mir669g (accession: 3783385) |
| References |
| [1]Calabrese JM, Seila AC, Yeo GW, Sharp PA, Proc Natl Acad Sci U S A. 104:18097-18102(2007)., "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells" |
This microRNA is imprinted (based on ncRNAimprinted database) |