| Basic information from miRBase |
| hairpin accession number: MI0008885 |
| Located between position 30303622 and 30303702 on chromosome 10 strand - |
| Overlapping with sense strand of XM_001135617.1 (intron 3). |
| (Ensemble: ENSPTRT00000004400) |
| mature miRNAs for MI0008885: |
| ptr-miR-938 (MIMAT0008345): TGCCCTTAAAGGTGAACCCAGT |
| You can find this miRNA in ENTREZGENE: MIR938 (accession: 100316405) |
| References |
| [1]Baev V, Daskalova E, Minkov I, Comput Biol Chem. 33:62-70(2009)., "Computational identification of novel microRNA homologs in the chimpanzee genome" |