| Basic information from miRBase |
| hairpin accession number: MI0004778 |
| Located between position 2309859 and 2309953 on chromosome 14 strand + |
| Overlapping with sense strand of Vault.4-201 (exon 1). |
| (Ensemble: ENSDART00000121948) |
| mature miRNAs for MI0004778: |
| dre-miR-733 (MIMAT0003763): TGCGTTGGTTTAGCTCAGTGGTT |
| You can find this miRNA in ENTREZGENE: mir733 (accession: 100033745) |
| References |
| [1]Kloosterman WP, Steiner FA, Berezikov E, de Bruijn E, van de Belt J, Verheul M, Cuppen E, Plasterk RH, Nucleic Acids Res. 34:2558-2569(2006)., "Cloning and expression of new microRNAs from zebrafish" |