miRNEST 2.0: an integrative microRNA resource miRNEST 2.0, an integrative microRNA resource :: Browse



Basic information from miRBase
hairpin accession number: MI0005476
Located between position 64033933 and 64034008 on chromosome X strand -
mature miRNAs for MI0005476:
         mmu-miR-883a-5p (MIMAT0004848): TGCTGAGAGAAGTAGCAGTTAC
         mmu-miR-883a-3p (MIMAT0004849): TAACTGCAACAGCTCTCAGTAT
You can find this miRNA in MGI: Mir883a (accession: 3718574)

References
[1]Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M, Cell. 129:1401-1414(2007)., "A mammalian microRNA expression atlas based on small RNA library sequencing"
[2]Calabrese JM, Seila AC, Yeo GW, Sharp PA, Proc Natl Acad Sci U S A. 104:18097-18102(2007)., "RNA sequence analysis defines Dicer's role in mouse embryonic stem cells"
[3]Ahn HW, Morin RD, Zhao H, Harris RA, Coarfa C, Chen ZJ, Milosavljevic A, Marra MA, Rajkovic A, Mol Hum Reprod. 16:463-471(2010)., "MicroRNA transcriptome in the newborn mouse ovaries determined by massive parallel sequencing"
[4]Chiang HR, Schoenfeld LW, Ruby JG, Auyeung VC, Spies N, Baek D, Johnston WK, Russ C, Luo S, Babiarz JE, Blelloch R, Schroth GP, Nusbaum C, Bartel DP, Genes Dev. 24:992-1009(2010)., "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes"